MAGeCK CRISPR Screen Analysis
Count sgRNAs from FASTQ
# Count reads mapping to sgRNA library
mageck count \
-l library.csv \
-n experiment \
--sample-label Day0,Treated1,Treated2,Control1,Control2 \
--fastq Day0.fastq.gz Treated1.fastq.gz Treated2.fastq.gz Control1.fastq.gz Control2.fastq.gz \
--norm-method median
# Output files:
# experiment.count.txt - normalized counts
# experiment.count_normalized.txt - normalized counts
# experiment.countsummary.txt - QC summary
Library File Format
# library.csv (tab-separated)
sgRNA_ID Gene Sequence
BRCA1_1 BRCA1 ATGGATTTATCTGCTCTTCG
BRCA1_2 BRCA1 CAGCAGATACTTGATGCATC
TP53_1 TP53 CCATTGTTCAATATCGTCCG
...
MAGeCK Test (RRA Algorithm)
# Compare treatment vs control
mageck test \
-k experiment.count.txt \
-t Treated1,Treated2 \
-c Control1,Control2 \
-n results \
--norm-method median \
--gene-test-fdr-threshold 0.25
# Output files:
# results.gene_summary.txt - gene-level results
# results.sgrna_summary.txt - sgRNA-level results
MAGeCK MLE (Maximum Likelihood)
# Create design matrix
# design.txt:
# Samples baseline treatment
# Day0 1 0
# Control1 1 0
# Control2 1 0
# Treated1 1 1
# Treated2 1 1
mageck mle \
-k experiment.count.txt \
-d design.txt \
-n mle_results \
--norm-method median
# Output: mle_results.gene_summary.txt with beta scores
Interpret Results
import pandas as pd
# Load gene summary
genes = pd.read_csv('results.gene_summary.txt', sep='\t')
# Negative selection (dropout/essential)
essential = genes[(genes['neg|fdr'] < 0.05)].sort_values('neg|rank')
print(f'Essential genes (dropout): {len(essential)}')
print(essential[['id', 'neg|score', 'neg|fdr']].head(20))
# Positive selection (enrichment/resistance)
resistant = genes[(genes['pos|fdr'] < 0.05)].sort_values('pos|rank')
print(f'Resistance genes (enriched): {len(resistant)}')
print(resistant[['id', 'pos|score', 'pos|fdr']].head(20))
Visualize Results
import pandas as pd
import matplotlib.pyplot as plt
import numpy as np
genes = pd.read_csv('results.gene_summary.txt', sep='\t')
# Volcano plot
fig, ax = plt.subplots(figsize=(10, 8))
x = genes['neg|lfc']
y = -np.log10(genes['neg|fdr'])
colors = ['red' if fdr < 0.05 else 'gray' for fdr in genes['neg|fdr']]
ax.scatter(x, y, c=colors, alpha=0.5, s=10)
# Label top hits
top_hits = genes[genes['neg|fdr'] < 0.01].nsmallest(10, 'neg|rank')
for _, row in top_hits.iterrows():
ax.annotate(row['id'], (row['neg|lfc'], -np.log10(row['neg|fdr'])))
ax.axhline(-np.log10(0.05), linestyle='--', color='black', alpha=0.5)
ax.set_xlabel('Log2 Fold Change')
ax.set_ylabel('-log10(FDR)')
ax.set_title('MAGeCK Negative Selection')
plt.savefig('mageck_volcano.png', dpi=150)
MAGeCK Pathway Analysis
# Gene set enrichment on screen results
mageck pathway \
-g results.gene_summary.txt \
-c go_biological_process.gmt \
-n pathway_results \
--pathway-fdr-threshold 0.25
Time-Course Screens
# Compare multiple timepoints
mageck mle \
-k timecourse.count.txt \
-d timecourse_design.txt \
-n timecourse_results
# Design matrix for time course:
# Samples baseline day7 day14
# Day0 1 0 0
# Day7_R1 1 1 0
# Day7_R2 1 1 0
# Day14_R1 1 0 1
# Day14_R2 1 0 1
CRISPR Activation (CRISPRa) Screens
# For CRISPRa, focus on positive selection
mageck test \
-k crispra.count.txt \
-t Activated1,Activated2 \
-c Control1,Control2 \
-n crispra_results
# Hits are genes where activation causes phenotype
# Use pos|fdr and pos|score columns
MAGeCK-VISPR (Visualization)
# Generate interactive report
mageck-vispr run \
-n vispr_report \
-c config.yaml
# config.yaml example:
# experiment: screen_name
# assembly: hg38
# species: homo_sapiens
# targets: library.csv
# sgrnas: experiment.count.txt
# samples:
# - Day0
# - Treated1
Related Skills
- screen-qc - Quality control before MAGeCK
- hit-calling - Alternative hit calling methods
- pathway-analysis/gsea - Downstream enrichment analysis