Reverse Complement
Generate complementary and reverse complementary sequences using Biopython.
Required Import
from Bio.Seq import Seq
Core Methods
reverse_complement()
Returns the reverse complement (5' to 3' of the opposite strand).
seq = Seq('ATGCGATCG')
rc = seq.reverse_complement() # Returns Seq('CGATCGCAT')
This is the most commonly used operation - it gives you the sequence of the opposite strand in the conventional 5' to 3' direction.
complement()
Returns the complement without reversing.
seq = Seq('ATGCGATCG')
comp = seq.complement() # Returns Seq('TACGCTAGC')
Less commonly used - gives the opposite strand but in 3' to 5' direction.
reverse_complement_rna()
For RNA sequences (uses U instead of T):
rna = Seq('AUGCGAUCG')
rc_rna = rna.reverse_complement_rna() # Returns Seq('CGAUCGCAU')
complement_rna()
rna = Seq('AUGCGAUCG')
comp_rna = rna.complement_rna() # Returns Seq('UACGCUAGC')
Base Pairing Rules
DNA
| Base | Complement |
|---|---|
| A | T |
| T | A |
| G | C |
| C | G |
RNA
| Base | Complement |
|---|---|
| A | U |
| U | A |
| G | C |
| C | G |
Ambiguous Bases (IUPAC)
| Code | Bases | Complement |
|---|---|---|
| R | A/G | Y |
| Y | C/T | R |
| S | G/C | S |
| W | A/T | W |
| K | G/T | M |
| M | A/C | K |
| B | C/G/T | V |
| D | A/G/T | H |
| H | A/C/T | D |
| V | A/C/G | B |
| N | A/C/G/T | N |
Biopython handles IUPAC ambiguity codes correctly.
Code Patterns
Basic Reverse Complement
seq = Seq('ATGCGATCGATCG')
rc = seq.reverse_complement()
print(f'Original: 5\'-{seq}-3\'')
print(f'RevComp: 5\'-{rc}-3\'')
Visualize Double-Stranded DNA
def show_dsdna(seq):
comp = seq.complement()
print(f"5'-{seq}-3'")
print(f" {'|' * len(seq)}")
print(f"3'-{comp}-5'")
seq = Seq('ATGCGATCG')
show_dsdna(seq)
Check if Sequence is Palindrome (Self-Complementary)
def is_palindrome(seq):
return seq == seq.reverse_complement()
seq1 = Seq('GAATTC') # EcoRI site - palindrome
seq2 = Seq('ATGCGA') # Not a palindrome
print(f'GAATTC is palindrome: {is_palindrome(seq1)}')
print(f'ATGCGA is palindrome: {is_palindrome(seq2)}')
Reverse Complement a FASTA File
from Bio import SeqIO
from Bio.SeqRecord import SeqRecord
def reverse_complement_records(records):
for record in records:
rc_record = SeqRecord(
record.seq.reverse_complement(),
id=record.id + '_rc',
description=record.description + ' reverse complement'
)
yield rc_record
records = SeqIO.parse('sequences.fasta', 'fasta')
rc_records = reverse_complement_records(records)
SeqIO.write(rc_records, 'sequences_rc.fasta', 'fasta')
Primer Design Helper
def design_primer_pair(template, start, end):
'''Design forward and reverse primers for a region'''
forward = template[start:start + 20]
reverse = template[end - 20:end].reverse_complement()
return forward, reverse
template = Seq('ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCG')
fwd, rev = design_primer_pair(template, 0, 40)
print(f'Forward primer (5\'-3\'): {fwd}')
print(f'Reverse primer (5\'-3\'): {rev}')
Handle Both Strands in Analysis
def search_both_strands(seq, motif):
'''Search for a motif on both strands'''
motif = Seq(motif)
results = []
pos = seq.find(motif)
while pos != -1:
results.append(('+', pos))
pos = seq.find(motif, pos + 1)
rc = seq.reverse_complement()
pos = rc.find(motif)
while pos != -1:
results.append(('-', len(seq) - pos - len(motif)))
pos = rc.find(motif, pos + 1)
return results
seq = Seq('ATGCGAATTCGATCGATGAATTCGATC')
hits = search_both_strands(seq, 'GAATTC')
for strand, pos in hits:
print(f'Found on {strand} strand at position {pos}')
Common Use Cases
| Task | Method |
|---|---|
| Get opposite strand | reverse_complement() |
| Primer for opposite strand | reverse_complement() of target region |
| Template strand from coding | reverse_complement() |
| Check palindrome | seq == seq.reverse_complement() |
| Search both strands | Search original and reverse_complement |
Common Errors
| Error | Cause | Solution |
|---|---|---|
| Wrong bases in result | Mixing DNA/RNA methods | Use reverse_complement_rna() for RNA |
TypeError | Passing string instead of Seq | Wrap in Seq() first |
Decision Tree
Need to work with strand orientation?
├── Get opposite strand sequence (5' to 3')?
│ └── Use reverse_complement()
├── Get base-paired sequence (same direction)?
│ └── Use complement()
├── Working with RNA?
│ └── Use reverse_complement_rna()
├── Check if restriction site (palindrome)?
│ └── seq == seq.reverse_complement()
└── Designing primers?
└── Reverse primer = reverse_complement() of 3' end
Related Skills
- seq-objects - Create Seq objects to complement
- transcription-translation - Six-frame translation uses reverse complement
- motif-search - Search both strands for motifs
- restriction-analysis - Restriction sites are often palindromic
- alignment-files - BAM FLAG indicates read strand; use samtools view -f 16 for reverse
