askill
bio-codon-usage

bio-codon-usageSafety 96Repository

Analyze codon usage, calculate CAI (Codon Adaptation Index), and examine synonymous codon bias using Biopython. Use when analyzing coding sequences for expression optimization or evolutionary analysis.

270 stars
5.4k downloads
Updated 2/17/2026

Package Files

Loading files...
SKILL.md

Version Compatibility

Reference examples tested with: BioPython 1.83+

Before using code patterns, verify installed versions match. If versions differ:

  • Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Codon Usage

Analyze codon usage patterns and calculate codon adaptation metrics using Biopython.

"Analyze codon usage" → Count codons in a coding sequence, compute frequencies and bias metrics.

  • Python: Counter on 3-mers + CodonAdaptationIndex (BioPython)

"Optimize codons for expression" → Replace codons with host-preferred synonymous codons using a preference table.

  • Python: custom mapping dict + Seq() (BioPython)

Required Imports

from Bio.Seq import Seq
from Bio.SeqUtils import GC123
from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex
from Bio.Data import CodonTable
from collections import Counter

Basic Codon Counting

Goal: Tabulate codon frequencies in a coding sequence.

Approach: Split the sequence into triplets from the reading frame start, then count with Counter.

Count Codons in Sequence

from collections import Counter

def count_codons(seq):
    seq_str = str(seq).upper()
    codons = [seq_str[i:i+3] for i in range(0, len(seq_str) - 2, 3)]
    return Counter(codons)

seq = Seq('ATGCGATCGATCGATCGTAA')
codon_counts = count_codons(seq)

Codon Frequencies (Relative)

def codon_frequencies(seq):
    counts = count_codons(seq)
    total = sum(counts.values())
    return {codon: count / total for codon, count in counts.items()}

Codon Adaptation Index (CAI)

Goal: Measure how well a gene's codon usage matches highly expressed genes in a target organism.

Approach: Train a CAI index from a reference set of highly expressed genes, then score query sequences (0-1 scale, higher = better adapted).

Using CodonUsage Module

from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex

# Create CAI calculator with reference set
cai = CodonAdaptationIndex()

# Generate index from highly expressed genes
cai.generate_index('highly_expressed_genes.fasta')

# Calculate CAI for a sequence
seq = Seq('ATGCGATCGATCGATCGTAA')
cai_value = cai.cai_for_gene(str(seq))
print(f'CAI: {cai_value:.3f}')  # Range 0-1, higher = better adapted

CAI with Custom Codon Index

from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex

cai = CodonAdaptationIndex()

# Set custom index (relative adaptiveness for each codon)
custom_index = {
    'TTT': 0.5, 'TTC': 1.0,  # Phe
    'TTA': 0.1, 'TTG': 0.5, 'CTT': 0.3, 'CTC': 1.0, 'CTA': 0.1, 'CTG': 1.0,  # Leu
    # ... define all 64 codons
}
cai.set_cai_index(custom_index)

Synonymous Codon Usage

Goal: Quantify bias in synonymous codon usage to detect selection or mutational pressure.

Approach: Calculate RSCU — the ratio of observed to expected frequency assuming equal usage of synonymous codons. RSCU = 1.0 means no bias; >1 overused, <1 underused.

RSCU (Relative Synonymous Codon Usage)

from Bio.Data import CodonTable

def calculate_rscu(seq, table_id=1):
    codon_table = CodonTable.unambiguous_dna_by_id[table_id]
    counts = count_codons(seq)

    # Group codons by amino acid
    aa_to_codons = {}
    for codon in counts:
        if codon in codon_table.stop_codons:
            continue
        try:
            aa = codon_table.forward_table[codon]
            aa_to_codons.setdefault(aa, []).append(codon)
        except KeyError:
            continue

    # Calculate RSCU for each codon
    rscu = {}
    for aa, codons in aa_to_codons.items():
        total = sum(counts.get(c, 0) for c in codons)
        n_synonymous = len(codons)
        expected = total / n_synonymous if n_synonymous > 0 else 0
        for codon in codons:
            observed = counts.get(codon, 0)
            rscu[codon] = observed / expected if expected > 0 else 0
    return rscu

Identify Rare Codons

def find_rare_codons(seq, threshold=0.1):
    freq = codon_frequencies(seq)
    return {codon: f for codon, f in freq.items() if f < threshold}

Codon Bias by Position (GC123)

from Bio.SeqUtils import GC123

seq = Seq('ATGCGATCGATCGATCGATCGATCGATCGTAA')
gc_total, gc_pos1, gc_pos2, gc_pos3 = GC123(seq)

print(f'Total GC: {gc_total:.1f}%')
print(f'1st position GC: {gc_pos1:.1f}%')
print(f'2nd position GC: {gc_pos2:.1f}%')
print(f'3rd position GC: {gc_pos3:.1f}% (wobble position)')

Codon Tables

Access Codon Tables

from Bio.Data import CodonTable

# Get standard table
std_table = CodonTable.unambiguous_dna_by_id[1]

# List all available tables
for id, table in CodonTable.unambiguous_dna_by_id.items():
    print(f'{id}: {table.names[0]}')

Common Codon Tables

IDNameOrganism
1StandardMost organisms
2Vertebrate MitochondrialHuman, mouse mito
4Mold MitochondrialFungi, protozoa mito
5Invertebrate MitochondrialInsects, worms mito
11Bacterial/PlastidE. coli, chloroplasts

Codon Table Properties

table = CodonTable.unambiguous_dna_by_id[1]

print(f'Start codons: {table.start_codons}')
print(f'Stop codons: {table.stop_codons}')

# Forward table: codon -> amino acid
print(table.forward_table['ATG'])  # 'M'

# Back table: amino acid -> list of codons
back_table = {}
for codon, aa in table.forward_table.items():
    back_table.setdefault(aa, []).append(codon)
print(f'Leucine codons: {back_table["L"]}')

Code Patterns

Full Codon Usage Report

def codon_usage_report(seq, table_id=1):
    from Bio.Data import CodonTable

    table = CodonTable.unambiguous_dna_by_id[table_id]
    counts = count_codons(seq)
    total = sum(counts.values())

    # Group by amino acid
    aa_groups = {}
    for codon, aa in table.forward_table.items():
        aa_groups.setdefault(aa, []).append(codon)

    report = {}
    for aa, codons in sorted(aa_groups.items()):
        aa_total = sum(counts.get(c, 0) for c in codons)
        report[aa] = {
            'total': aa_total,
            'codons': {c: {'count': counts.get(c, 0),
                          'freq': counts.get(c, 0) / aa_total if aa_total > 0 else 0}
                      for c in codons}
        }
    return report

Compare Codon Usage Between Sequences

def compare_codon_usage(seq1, seq2):
    freq1 = codon_frequencies(seq1)
    freq2 = codon_frequencies(seq2)

    all_codons = set(freq1.keys()) | set(freq2.keys())
    comparison = {}
    for codon in sorted(all_codons):
        f1, f2 = freq1.get(codon, 0), freq2.get(codon, 0)
        comparison[codon] = {'seq1': f1, 'seq2': f2, 'diff': f1 - f2}
    return comparison

Optimize Codons for Expression

Goal: Replace codons with host-preferred synonymous alternatives to maximize protein expression.

Approach: Map each amino acid to its most-preferred codon in the target host, then reconstruct the DNA sequence.

def optimize_codons(protein_seq, preferred_codons):
    '''Replace codons with preferred synonymous codons'''
    optimized = []
    for aa in str(protein_seq):
        if aa in preferred_codons:
            optimized.append(preferred_codons[aa])
        else:
            optimized.append('NNN')  # Unknown
    return Seq(''.join(optimized))

# E. coli preferred codons
ecoli_preferred = {
    'A': 'GCG', 'R': 'CGT', 'N': 'AAC', 'D': 'GAT', 'C': 'TGC',
    'Q': 'CAG', 'E': 'GAA', 'G': 'GGT', 'H': 'CAC', 'I': 'ATT',
    'L': 'CTG', 'K': 'AAA', 'M': 'ATG', 'F': 'TTC', 'P': 'CCG',
    'S': 'TCT', 'T': 'ACC', 'W': 'TGG', 'Y': 'TAC', 'V': 'GTT',
}

Codon Usage from FASTA File

from Bio import SeqIO

def analyze_fasta_codon_usage(filename):
    all_counts = Counter()
    for record in SeqIO.parse(filename, 'fasta'):
        all_counts.update(count_codons(record.seq))

    total = sum(all_counts.values())
    return {codon: count / total for codon, count in all_counts.items()}

Effective Number of Codons (Nc)

A measure of codon bias (lower = more biased, range 20-61):

import math

def effective_nc(seq, table_id=1):
    from Bio.Data import CodonTable
    table = CodonTable.unambiguous_dna_by_id[table_id]
    counts = count_codons(seq)

    # Group by degeneracy class
    aa_groups = {}
    for codon, aa in table.forward_table.items():
        aa_groups.setdefault(aa, []).append(codon)

    # Calculate F for each amino acid
    nc_sum = 0
    for aa, codons in aa_groups.items():
        n = sum(counts.get(c, 0) for c in codons)
        if n <= 1:
            continue
        pi_sq_sum = sum((counts.get(c, 0) / n) ** 2 for c in codons)
        F = (n * pi_sq_sum - 1) / (n - 1)
        nc_sum += 1 / F if F > 0 else len(codons)

    return nc_sum if nc_sum > 0 else 61

Property Reference

MetricRangeInterpretation
CAI0-1Higher = better adapted to host
RSCU0-N1.0 = no bias, >1 = overused, <1 = underused
Nc20-61Lower = more biased
GC30-100%GC at wobble position

Common Errors

ErrorCauseSolution
KeyErrorNon-standard codonHandle N-containing codons
Wrong countsSequence not in frameEnsure length is multiple of 3
No index setCalled CAI without trainingCall generate_index() first

Decision Tree

Need to analyze codon usage?
├── Count codon frequencies?
│   └── Use Counter on 3-mers
├── Calculate adaptation to host?
│   └── Use CodonAdaptationIndex (CAI)
├── Identify synonymous bias?
│   └── Calculate RSCU
├── Check wobble position bias?
│   └── Use GC123()
├── Measure overall bias?
│   └── Calculate Nc (effective number of codons)
└── Optimize for expression?
    └── Replace with preferred synonymous codons

Related Skills

  • transcription-translation - Translate sequences and understand codon tables
  • sequence-properties - GC123 for wobble position GC content
  • sequence-io/read-sequences - Parse CDS sequences from GenBank files
  • database-access/entrez-fetch - Fetch reference gene sets from NCBI for CAI training

Install

Download ZIP
Requires askill CLI v1.0+

AI Quality Score

96/100Analyzed 2/22/2026

Metadata

Licenseunknown
Version-
Updated2/17/2026
PublisherGPTomics

Tags

apidatabaseobservability